-
PurposeExpresses GFP-tagged HRS 2xFYVE in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 4219
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametandem HRS FYVE domain
-
Alt nameHGS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)486
-
Mutationtwo FYVE domains (amino acids 147-223), linked by QGQGS linker
-
GenBank ID15239
-
Entrez GeneHgs (a.k.a. H, Hgr, Hrs, ZFYVE8, t, tn)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI in backbone/MfeI in insert (destroyed during cloning)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-2xFYVE was a gift from Harald Stenmark (Addgene plasmid # 140047 ; http://n2t.net/addgene:140047 ; RRID:Addgene_140047) -
For your References section:
Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. Gillooly DJ, Morrow IC, Lindsay M, Gould R, Bryant NJ, Gaullier JM, Parton RG, Stenmark H. EMBO J. 2000 Sep 1;19(17):4577-88. doi: 10.1093/emboj/19.17.4577. 10.1093/emboj/19.17.4577 PubMed 10970851