-
PurposeFor curing of Orbit-integrated plasmids and associated drug marker
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKM461
-
Backbone manufacturerK. Murphy
- Backbone size w/o insert (bp) 816
- Total vector size (bp) 9906
-
Modifications to backboneReplaced RecT with gp47 Replaced kanamycin resistance gene with zeo resistance gene
-
Vector typeBacterial Expression
-
Selectable markersZeocin ; Grow in LB containing 25 ug/mL zeocin.
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namezeocin resistance gene
-
Insert Size (bp)597
-
MutationKanamycin resistance gene in pKM461 replaced with zeocin resistance gene by recombineering
- Promoter EM7
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
- 3′ sequencing primer CCGGTGAAGTCGTAGCATCGGTGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBxb1gp47 (directionality factor)
-
SpeciesMycobacterial phage Bxb1
-
Insert Size (bp)822
-
MutationCloned in gp47 directinality factor in place of RecT in pKM511 (a Zeo version of pKM461)
- Promoter Ptet
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KasI (not destroyed)
- 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
- 3′ sequencing primer CCGGTGAAGTCGTAGCATCGGTGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygp47 gene was received from Graham Hatfull
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be used to removed ORBIT integrated plasmids leaving behind an Bxb1 attP site. After deletion of a target gene using ORBIT, the integrated plasmid (e.g., pKM464 - hygR) is excised by expressing phage Bxb1 Integrase and gp47 (directionality factor) from pKM512. A strain containing an ORBIT-generated deletion is transformed with pKM512 selecting for zeocin resistance. (This step cures the cell of pKM461 (kanR) used to make the deletion.) Select a zeoR colony containing pKM512 and grow to saturation in 7H10-zeocin. Dilute the culture 100-fold and regrow the strain in 7H10 without zeocin, but include 500 ng/ml anhydrotetracycline, (which induces expression of Integrase and gp47). Grow to saturation again, plate for single colonies, stab colonies on 7H10 plates containing 10% sucrose (Smeg) or 3% sucrose (Mtb) looking for hygromycin-sensitive colonies. Colonies should also be sensitive to kanamycin and zeocin. Once performed, the strain cannot be used for deletion of a second gene using ORBIT, as an attP site is now present at the site of the initial deletion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM512 was a gift from Kenan Murphy (Addgene plasmid # 140192 ; http://n2t.net/addgene:140192 ; RRID:Addgene_140192) -
For your References section:
ORBIT: a New Paradigm for Genetic Engineering of Mycobacterial Chromosomes. Murphy KC, Nelson SJ, Nambi S, Papavinasasundaram K, Baer CE, Sassetti CM. MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18. 10.1128/mBio.01467-18 PubMed 30538179