pmCherry-U6-ALDH1A3
(Plasmid
#140589)
-
PurposeExpresses a gRNA and mCherry in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 140589-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 140589-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmCherry-U6
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA ALDH1A3
-
gRNA/shRNA sequenceGGAGAGGGACCGCGCCACCT
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 140589-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 140589-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-U6-ALDH1A3 was a gift from Feng Zhang (Addgene plasmid # 140589 ; http://n2t.net/addgene:140589 ; RRID:Addgene_140589) -
For your References section:
Highly Parallel Profiling of Cas9 Variant Specificity. Schmid-Burgk JL, Gao L, Li D, Gardner Z, Strecker J, Lash B, Zhang F. Mol Cell. 2020 Mar 17. pii: S1097-2765(20)30143-X. doi: 10.1016/j.molcel.2020.02.023. 10.1016/j.molcel.2020.02.023 PubMed 32187529