-
PurposeT7 promoter driven synthesis of T3 RNA polymerase
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6437
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT3 RNA polymerase
-
Alt nameT3 RNAP
-
Speciesphage T3
-
Insert Size (bp)2700
- Promoter T7 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgaggatcttaaggctagag
- 3′ sequencing primer ctgcaggaattcgatatcaagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC101-pT7-T3RNAP was a gift from Neal Devaraj (Addgene plasmid # 140872 ; http://n2t.net/addgene:140872 ; RRID:Addgene_140872) -
For your References section:
Communication and quorum sensing in non-living mimics of eukaryotic cells. Niederholtmeyer H, Chaggan C, Devaraj NK. Nat Commun. 2018 Nov 28;9(1):5027. doi: 10.1038/s41467-018-07473-7. 10.1038/s41467-018-07473-7 PubMed 30487584