Skip to main content

pHLuc (Antares-SEPLuc C1A4E+6)
(Plasmid #141089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141089 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 141089-D50 50 μg of DNA in Tris buffer $495
DNA 141089-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 9169
  • Modifications to backbone
    Neomycin deleted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Antares-T2A-puromycin-IRESv24-SEP-C1A4E+6
  • Alt name
    pHLuc
  • Alt name
    Antares-SEPLuc C1A4E+6
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    4563
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 forward (TTAATACGACTCACTATAGGG)
  • 3′ sequencing primer BGH reverse (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLuc (Antares-SEPLuc C1A4E+6) was a gift from Jeak Ling Ding (Addgene plasmid # 141089 ; http://n2t.net/addgene:141089 ; RRID:Addgene_141089)
  • For your References section:

    pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886