pGAL4-DBD-HOXA13wt-IDR
(Plasmid
#145240)
-
PurposeExpresses fusion of GAL4 DNA-binding domain and HOXA13wt IDR
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Molecular Genetics
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 145240-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 145240-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHOXA13wt-IDR
-
SpeciesH. sapiens (human)
-
Entrez GeneHOXA13 (a.k.a. HOX1, HOX1J)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer agactgatatgcctctaaca
- 3′ sequencing primer GAGAAAGGAAGGGAAGAAAGCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 145240-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 145240-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAL4-DBD-HOXA13wt-IDR was a gift from Denes Hnisz (Addgene plasmid # 145240 ; http://n2t.net/addgene:145240 ; RRID:Addgene_145240) -
For your References section:
Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Basu S, Mackowiak SD, Niskanen H, Knezevic D, Asimi V, Grosswendt S, Geertsema H, Ali S, Jerkovic I, Ewers H, Mundlos S, Meissner A, Ibrahim DM, Hnisz D. Cell. 2020 May 28;181(5):1062-1079.e30. doi: 10.1016/j.cell.2020.04.018. Epub 2020 May 7. 10.1016/j.cell.2020.04.018 PubMed 32386547