Skip to main content

pEAK-bKal7
(Plasmid #145800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145800 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 145800-D50 50 μg of DNA in Tris buffer $495
DNA 145800-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEAK
  • Backbone manufacturer
    Edge Biosystems
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 11000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bKalirin-7
  • Alt name
    bKal7
  • Alt name
    Ka7b
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    5000
  • GenBank ID
    U88156.1
  • Entrez Gene
    Kalrn (a.k.a. Duo, Hapip, Kalirin)
  • Promoter EIF2a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (destroyed during cloning)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer CTGGGCTGGCTTACCTGCGGCCGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEAK-bKal7 was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145800 ; http://n2t.net/addgene:145800 ; RRID:Addgene_145800)
  • For your References section:

    Alternate promoter usage generates two subpopulations of the neuronal RhoGEF Kalirin-7. Miller MB, Yan Y, Wu Y, Hao B, Mains RE, Eipper BA. J Neurochem. 2017 Mar;140(6):889-902. doi: 10.1111/jnc.13749. Epub 2016 Sep 6. 10.1111/jnc.13749 PubMed 27465683