pEAK-cKal7
(Plasmid
#145801)
-
Purposeexpresses Kalirin-7 with the c-front in mammalian cells
-
Depositing Labs
-
Depositing OrganizationUniversity of Connecticut Health Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 145801-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 145801-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEAK
-
Backbone manufacturerEdge Biosystems
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 11200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecKalirin-7
-
Alt namecKal7
-
Alt nameKal7c
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)5000
-
GenBank IDAF230644.1
-
Entrez GeneKalrn (a.k.a. Duo, Hapip, Kalirin)
- Promoter EIF2a
-
Tag
/ Fusion Protein
- none (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (destroyed during cloning)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer CTGGGCTGGCTTACCTGCGGCCGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 145801-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 145801-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEAK-cKal7 was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145801 ; http://n2t.net/addgene:145801 ; RRID:Addgene_145801) -
For your References section:
Alternate promoter usage generates two subpopulations of the neuronal RhoGEF Kalirin-7. Miller MB, Yan Y, Wu Y, Hao B, Mains RE, Eipper BA. J Neurochem. 2017 Mar;140(6):889-902. doi: 10.1111/jnc.13749. Epub 2016 Sep 6. 10.1111/jnc.13749 PubMed 27465683