prk5-MFSD12-TEV-3xFLAG-3xHA
(Plasmid
#149504)
-
PurposeTransient expression of human MFSD12 with recoded nucleotide sequence.
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 149504-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 149504-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneprk5
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression ; Transient Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMFSD12
-
Alt nameC19orf28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1440
-
MutationCodon Optimized Sequence
-
Entrez GeneMFSD12 (a.k.a. C19orf28, PP3501)
- Promoter CMV
-
Tag
/ Fusion Protein
- TEV-3XHA-3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACGATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 149504-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 149504-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prk5-MFSD12-TEV-3xFLAG-3xHA was a gift from David Sabatini (Addgene plasmid # 149504 ; http://n2t.net/addgene:149504 ; RRID:Addgene_149504) -
For your References section:
MFSD12 mediates the import of cysteine into melanosomes and lysosomes. Adelmann CH, Traunbauer AK, Chen B, Condon KJ, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nature. 2020 Nov 18. pii: 10.1038/s41586-020-2937-x. doi: 10.1038/s41586-020-2937-x. 10.1038/s41586-020-2937-x PubMed 33208952