Skip to main content
Addgene
Open Menu

pGL3-Enhancer-ZC3H12D_PromoterMUT
(Plasmid #153068)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153068 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 153068-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 153068-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL3-Enhancer
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5059
  • Total vector size (bp) 5694
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZC3H12D promoter region mutated in BHLHE40 binding sites
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    635
  • Mutation
    Mutagenesis to disrupt 3 BHLHE40 binding sites. New BamHI, EcoRI and EcoRV restriction sites were inserted by mutagenesis disrupting binding sites at position 185, 337 and 436 of the insert.
  • Entrez Gene
    ZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Unavailable
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There exist several polymorphisms in the promoter region that do not functionally impact the plasmid. They represent discrepancies compared to the human reference genome (hg38).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Enhancer-ZC3H12D_PromoterMUT was a gift from Silvia Monticelli (Addgene plasmid # 153068 ; http://n2t.net/addgene:153068 ; RRID:Addgene_153068)

  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878
Related items:
Commonly requested with: