Skip to main content

pSCIP-hCD69-TdTomato
(Plasmid #154095)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154095 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 154095-D50 50 μg of DNA in Tris buffer $495
DNA 154095-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pQCi
  • Backbone manufacturer
    Derived from pX458 (Zhang lab)
  • Backbone size w/o insert (bp) 9500
  • Modifications to backbone
    Modular BAIT site integrated (BsaI sites) Intron integrated into spCas9 sequence
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    GFP and tdTomato
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    [5HA]-P2A-tdTomato-[3HA]
  • Alt name
    5' and 3' homology arms for insertion into human CD69 locus
  • Alt name
    P2A-TdTomato Fluorescent protein
  • Species
    Synthetic

Gene/Insert 2

  • Gene/Insert name
    hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCIP-hCD69-TdTomato was a gift from Scott McComb (Addgene plasmid # 154095 ; http://n2t.net/addgene:154095 ; RRID:Addgene_154095)
  • For your References section:

    Self-Cutting and Integrating CRISPR Plasmids Enable Targeted Genomic Integration of Genetic Payloads for Rapid Cell Engineering. Bloemberg D, Sosa-Miranda CD, Nguyen T, Weeratna RD, McComb S. CRISPR J. 2021 Feb;4(1):104-119. doi: 10.1089/crispr.2020.0090. 10.1089/crispr.2020.0090 PubMed 33616439