pEF1α-squirrel-monkey-retroCHMP3-T2A-H2B-BFP
(Plasmid
#154185)
-
Purposeexpresses squirrel monkey retroCHMP3 with self-cleaving tag in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Utah
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 154185-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 154185-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF-GFP
-
Backbone manufacturer#11154
- Backbone size w/o insert (bp) 1668
- Total vector size (bp) 5985
-
Modifications to backbonedeleted GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameretroCHMP3
-
SpeciesS. sciureus (squirrel monkey)
-
Insert Size (bp)495
- Promoter EF1-alpha
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- T2A-H2B-BFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggaatttgccctttttgagtttgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKate Bredbenner, Sanford M. Simon laboratory, Rockefeller University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 154185-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 154185-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1α-squirrel-monkey-retroCHMP3-T2A-H2B-BFP was a gift from Wesley Sundquist (Addgene plasmid # 154185 ; http://n2t.net/addgene:154185 ; RRID:Addgene_154185) -
For your References section:
RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582