Skip to main content
Addgene
Open Menu

pEF1α-owl-monkey-retroCHMP3-HA
(Plasmid #154249)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154249 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 154249-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 154249-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEF-GFP
  • Backbone manufacturer
    #11154
  • Backbone size w/o insert (bp) 4311
  • Total vector size (bp) 5027
  • Modifications to backbone
    deleted GFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    retroCHMP3
  • Species
    Aotus nancyma (owl monkey)
  • Insert Size (bp)
    716
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggaatttgccctttttgagtttgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Diane Downhour, Nels Elde laboratory, University of Utah

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1α-owl-monkey-retroCHMP3-HA was a gift from Wesley Sundquist (Addgene plasmid # 154249 ; http://n2t.net/addgene:154249 ; RRID:Addgene_154249)

  • For your References section:

    Recurrent evolution of an inhibitor of ESCRT-dependent virus budding and LINE-1 retrotransposition in primates. Rheinemann L, Downhour DM, Davenport KA, McKeown AN, Sundquist WI, Elde NC. Curr Biol. 2022 Feb 25. pii: S0960-9822(22)00240-8. doi: 10.1016/j.cub.2022.02.018. 10.1016/j.cub.2022.02.018 PubMed 35245459
Related items:
Commonly requested with: