pCS2+-Pard3-EGFP-PIF6
(Plasmid
#154914)
-
PurposeFull length zebrafish Pard3 (Gene ID: 403050), tagged with EGFP fluorescent protein and Arabidopsis PIF6 (as in construct Addgene ID 154913).
-
Depositing Labs
-
Depositing OrganizationKing's College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 154914-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 154914-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCS2+
-
Backbone manufacturerRZPD
- Backbone size w/o insert (bp) 4095
- Total vector size (bp) 8531
-
Vector typeMammalian Expression ; xenopus/avian/zebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepar-3 family cell polarity regulator alpha, b
-
Alt namePard3, Pard3ab
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)4461
-
GenBank ID403050
-
Entrez Genepard3ab (a.k.a. asip, bazooka, par-3, par3, pard3)
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- 1-100 amino acids of Arabidopsis PIF6 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6 Forward ATTTAGGTGACACTATAG
- 3′ sequencing primer M13 Reverse GGAAACAGCTATGACCATG, T3 Forward AATTAACCCTCACTAAAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 154914-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 154914-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+-Pard3-EGFP-PIF6 was a gift from Clare Buckley & Jonathan Clarke (Addgene plasmid # 154914 ; http://n2t.net/addgene:154914 ; RRID:Addgene_154914) -
For your References section:
Reversible Optogenetic Control of Subcellular Protein Localization in a Live Vertebrate Embryo. Buckley CE, Moore RE, Reade A, Goldberg AR, Weiner OD, Clarke JD. Dev Cell. 2016 Jan 11;36(1):117-26. doi: 10.1016/j.devcel.2015.12.011. 10.1016/j.devcel.2015.12.011 PubMed 26766447