pTol2CG2-QUASM1:GFPNLS-SV40pA
(Plasmid
#155123)
-
PurposeTol2 vector containing QUASM1 reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis marker
-
Depositing Lab
-
Depositing OrganizationHospital for Sick Children
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 155123-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 155123-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDestTol2CG2 (Tol2 kit 1.0 #395)
-
Backbone manufacturerEsther Fujimoto, Chien lab
- Backbone size w/o insert (bp) 6251
- Total vector size (bp) 7869
-
Modifications to backbonecmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
-
Vector typeZebrafish expression
-
Selectable markerscmlc2:mRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQUASM1:GFPNLS
-
SpeciesSynthetic
-
Insert Size (bp)1618
-
GenBank ID
- Promoter QUASM1-E1b
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gctgcaaatagcaggaaacg
- 3′ sequencing primer GAGGATCATAATCAGCCATA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 155123-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 155123-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2CG2-QUASM1:GFPNLS-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155123 ; http://n2t.net/addgene:155123 ; RRID:Addgene_155123) -
For your References section:
An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972