Skip to main content

pTol2CG2-QUASM1:GFPNLS-SV40pA
(Plasmid #155123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155123 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 155123-D50 50 μg of DNA in Tris buffer $495
DNA 155123-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDestTol2CG2 (Tol2 kit 1.0 #395)
  • Backbone manufacturer
    Esther Fujimoto, Chien lab
  • Backbone size w/o insert (bp) 6251
  • Total vector size (bp) 7869
  • Modifications to backbone
    cmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
  • Vector type
    Zebrafish expression
  • Selectable markers
    cmlc2:mRFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QUASM1:GFPNLS
  • Species
    Synthetic
  • Insert Size (bp)
    1618
  • GenBank ID
  • Promoter QUASM1-E1b

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gctgcaaatagcaggaaacg
  • 3′ sequencing primer GAGGATCATAATCAGCCATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2CG2-QUASM1:GFPNLS-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155123 ; http://n2t.net/addgene:155123 ; RRID:Addgene_155123)
  • For your References section:

    An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972