pTol2CG2-QUAS5x:GFPNLS-SV40pA
(Plasmid
#155122)
-
PurposeTol2 vector containing QUAS5x reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDestTol2CG2 (Tol2 kit 1.0 #395)
-
Backbone manufacturerEsther Fujimoto, Chien lab
- Backbone size w/o insert (bp) 6251
- Total vector size (bp) 7869
-
Modifications to backbonecmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
-
Vector typeZebrafish expression
-
Selectable markerscmlc2:mRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQUAS5x:GFPNLS
-
SpeciesSynthetic
-
Insert Size (bp)1618
- Promoter QUAS5x-E1b
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gctgcaaatagcaggaaacg
- 3′ sequencing primer GAGGATCATAATCAGCCATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2CG2-QUAS5x:GFPNLS-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155122 ; http://n2t.net/addgene:155122 ; RRID:Addgene_155122) -
For your References section:
An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972