-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 15776-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 15776-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmGFP-c1 ( modified from pEGFP-c1)
-
Backbone manufacturerGlick Lab
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec16L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6465
-
MutationK466R
-
GenBank IDDQ903855
-
Entrez GeneSEC16A (a.k.a. KIAA0310, SEC16L, p250)
-
Tag
/ Fusion Protein
- mGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site Sma I (destroyed during cloning)
- 5′ sequencing primer catggtcctgctggagttcgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that we have identified a K466R missense mutation in the Sec16L/Sec16A region of this plasmid, and the start codon may not have been correctly identified when constructing this plasmid which may have resulted in the gene being truncated. However, we do not think that this should impact plasmid functionality.
DNA (Catalog # 15776-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 15776-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ; http://n2t.net/addgene:15776 ; RRID:Addgene_15776) -
For your References section:
Two mammalian Sec16 homologues have nonredundant functions in endoplasmic reticulum (ER) export and transitional ER organization. Bhattacharyya D, Glick BS. Mol Biol Cell. 2007 Mar;18(3):839-49. doi: 10.1091/mbc.e06-08-0707 10.1091/mbc.e06-08-0707 PubMed 17192411
Map uploaded by the depositor.
