Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmGFP-Sec16S
(Plasmid #15775)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15775 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmGFPc1( modified from pEGFP-c1)
  • Backbone manufacturer
    Glick Lab
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec16S
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3183
  • Mutation
    N/A
  • GenBank ID
    EF125213
  • Entrez Gene
    SEC16B (a.k.a. LZTR2, PGPR-p117, RGPR, RGPR-p117, SEC16S)
  • Tag / Fusion Protein
    • mGP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ecl136II (destroyed during cloning)
  • 3′ cloning site Ecl136II (destroyed during cloning)
  • 5′ sequencing primer catggtcctgctggagttcgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmGFP-Sec16S was a gift from Benjamin Glick (Addgene plasmid # 15775 ; http://n2t.net/addgene:15775 ; RRID:Addgene_15775)
  • For your References section:

    Two mammalian Sec16 homologues have nonredundant functions in endoplasmic reticulum (ER) export and transitional ER organization. Bhattacharyya D, Glick BS. Mol Biol Cell. 2007 Mar . 18(3):839-49. 10.1091/mbc.e06-08-0707 PubMed 17192411