pJL2-mGold-P2A-EBFP2
(Plasmid
#157998)
-
PurposeCo-expression of mGold and EBFP2 in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 157998-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 157998-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJL2
- Backbone size w/o insert (bp) 6992
- Total vector size (bp) 8507
-
Vector typeMammalian Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGold-P2A-EBFP2
-
SpeciesSynthetic
-
Insert Size (bp)1515
-
MutationmGold is mVenus with L46F;T63S mutations
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A mammalian expression cassette was cloned into a yeast vector.
mGold: FPBaseID TBD
EBFP2: FPBaseID DVMQ7 Please note that the mVenus annotation in the plasmid map is incorrect, as this plasmid encodes mGold.
DNA (Catalog # 157998-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 157998-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL2-mGold-P2A-EBFP2 was a gift from Francois St-Pierre (Addgene plasmid # 157998 ; http://n2t.net/addgene:157998 ; RRID:Addgene_157998) -
For your References section:
Versatile phenotype-activated cell sorting. Lee J, Liu Z, Suzuki PH, Ahrens JF, Lai S, Lu X, Guan S, St-Pierre F. Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct. 10.1126/sciadv.abb7438 PubMed 33097540