pDOC-K-glmS-GFPfor
(Plasmid
#158059)
-
PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the forward orientation relative to the kanamycin resistance selectable marker
-
Depositing Lab
-
Depositing OrganizationQuadram Institute Bioscience
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDOC-K-glmS
-
Backbone manufacturerAddgene #158058
- Backbone size w/o insert (bp) 8079
- Total vector size (bp) 8895
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen Fluorescent Protein optimised for excitation with UV light
-
Alt nameGFPuv
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)717
- Promoter acpP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer GTTGCAAATTTTTCAACATTT
- 3′ sequencing primer TTATTTGTAGAGCTCATCCATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAmplified from pZEP08 in Hautefort, I., Proença, M. J., and Hinton, J. C. (2003) Single-copy green fluorescent protein gene fusions allow accurate measurement of Salmonella gene expression in vitro and during infection of mammalian cells, Appl. Environ. Microbiol. 69, 7480-7491
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDOC-K-glmS-GFPfor was a gift from Mark Webber (Addgene plasmid # 158059 ; http://n2t.net/addgene:158059 ; RRID:Addgene_158059) -
For your References section:
Donor plasmids for phenotypically neutral chromosomal gene insertions in Enterobacteriaceae. Holden ER, Wickham GJ, Webber MA, Thomson NM, Trampari E. Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994. 10.1099/mic.0.000994 PubMed 33226934