pEMS2271
(Plasmid #158418)

• Purpose: AAV plasmid with Ple341 (PCP2 MiniPromoter) driving expression of EmGFP. Contains WPRE.
• Depositing Lab: Elizabeth Simpson
• Publication: Korecki et al Gene Ther. 2021 Feb 2. pii: 10.1038/s41434-021-00227-z. doi: 10.1038/s41434-021-00227-z.

Backbone

• Vector backbone: pEMS2131
• Backbone manufacturer: Elizabeth Simpson (Addgene plasmid # 111895)
• Backbone size w/o insert (bp): 4999
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): SURE cells
• Growth instructions: “SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ple341
• Alt name: PCP2 MiniPromoter
• Species: H. sapiens (human)
• Insert Size (bp): 784
• Entrez Gene: PCP2 (a.k.a. GPSM4, PCD5)
• Promoter: Ple341

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: oEMS6098 (GCCATGCTCTAGGAAGATCG)
• 3′ sequencing primer: oEMS6152 (CTGGCTTAGGGAGGACTTGC)

Resource Information

• Supplemental Documents:
  • pEMS2271.gb
• A portion of this plasmid was derived from a plasmid made by: DNA synthesized at GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see the annotated GenBank file and the additional image file for the specific location of features in this plasmid.