-
PurposeBioluminescent repair reporter (BLRR) for DNA double strand break (DSB) repairs: homology-directed repair (HDR) and non-homologous end joining (NHEJ).
-
Depositing Lab
-
Depositing OrganizationInstitute of Atomic and Molecular Sciences, Academia Sinica
Located in Taiwan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti CMV Puro DEST (w118-1)
- Backbone size w/o insert (bp) 7983
- Total vector size (bp) 10295
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBLRR
-
Alt namepDEST-BLRR
-
SpeciesSynthetic
-
Insert Size (bp)2312
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GACACCGACTCTAGTCCA
- 3′ sequencing primer TCCAGAGGTTGATTGTCGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe pLenti backbone came from Addgene plasmid #17452
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-BLRR was a gift from Charles P. Lai (Addgene plasmid # 158958 ; http://n2t.net/addgene:158958 ; RRID:Addgene_158958) -
For your References section:
A multiplexed bioluminescent reporter for sensitive and non-invasive tracking of DNA double strand break repair dynamics in vitro and in vivo. Chien JC, Tabet E, Pinkham K, da Hora CC, Chang JC, Lin S, Badr CE, Lai CP. Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669. 10.1093/nar/gkaa669 PubMed 32797168