AAVS1-pur-CAG-Bi-DREADD
(Plasmid
#159457)
-
PurposeAAVS1 targeting donor plasmid with Bi-DREADD expression cassette (hM3Dq-mCherry-P2A-HA-KORD) and puromycin selection gene
-
Depositing Lab
-
Depositing OrganizationCenter for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 159457-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 159457-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAAVS1-CAG
- Backbone size w/o insert (bp) 10200
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBi-DREADD
-
Alt namehM3Dq-mCherry-P2A-HA-KORD
-
SpeciesSynthetic
-
Insert Size (bp)3741
-
Mutationfusion protein of hM3Dq-mCherry and HA-KORD seperated by P2A sequence
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ggcttctggcgtgtgaccggc
- 3′ sequencing primer catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 159457-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 159457-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-pur-CAG-Bi-DREADD was a gift from Yuejun Chen (Addgene plasmid # 159457 ; http://n2t.net/addgene:159457 ; RRID:Addgene_159457) -
For your References section:
Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang SC. Cell Stem Cell. 2020 Sep 16. pii: S1934-5909(20)30410-0. doi: 10.1016/j.stem.2020.08.014. 10.1016/j.stem.2020.08.014 PubMed 32966778