pSF11-wNIR-GECO2-T2A-HO1
(Plasmid #159606)

• Purpose: Codon-optimized near-infrared fluorescent calcium indicator NIR-GECO2 with codon-optimized heme-oxygenase in C.elegans expression plasmid
• Depositing Lab: Robert Campbell
• Publication: Qian et al PLoS Biol. 2020 Nov 24;18(11):e3000965. doi: 10.1371/journal.pbio.3000965. eCollection 2020 Nov.

Backbone

• Vector backbone: pSF11
• Backbone size w/o insert (bp): 6090
• Total vector size (bp): 8508
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: wNIR-GECO2-T2A-HO1
• Alt name: Codon optimized NIR-GECO2 and HO1 for worm expression
• Species: Synthetic
• Insert Size (bp): 2418
• Promoter: tag-168

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctagaggatccccgggattgg
• 3′ sequencing primer: tgttgaagagtaattggacttagaagt

Resource Information

• Supplemental Documents:
  • pSF11-wNIR-GECO2-T2A-HO1.gbk
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.04.08.032433v2 for bioRxiv preprint.