Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJG100
(Plasmid #138966)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138966 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Backbone size w/o insert (bp) 2626
  • Total vector size (bp) 4730
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    wrmScarlet1-10
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    780

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGGTATCGAAGGGAGAAGC
  • 3′ sequencing primer TTAGTACTCGTTGTGGGAGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJG100 was a gift from Cynthia Kenyon (Addgene plasmid # 138966 ; http://n2t.net/addgene:138966 ; RRID:Addgene_138966)
  • For your References section:

    Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Goudeau J, Sharp CS, Paw J, Savy L, Leonetti MD, York AG, Updike DL, Kenyon C, Ingaramo M. Genetics. 2021 Apr 15;217(4). pii: 6126424. doi: 10.1093/genetics/iyab014. 10.1093/genetics/iyab014 PubMed 33693628