Intron-Tagging-EGFP-Donor
(Plasmid
#159740)
-
PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 1982
- Total vector size (bp) 2936
-
Vector typeIntron tagging donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt namesgRNA-SA-(GGGGS)x4-EGFP-(GGGGS)x4-SD-sgRNA
-
Insert Size (bp)954
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgcggcctttttacggttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Intron-Tagging-EGFP-Donor was a gift from Stefan Kubicek (Addgene plasmid # 159740 ; http://n2t.net/addgene:159740 ; RRID:Addgene_159740) -
For your References section:
Pooled protein tagging, cellular imaging, and in situ sequencing for monitoring drug action in real time. Reicher A, Koren A, Kubicek S. Genome Res. 2020 Dec;30(12):1846-1855. doi: 10.1101/gr.261503.120. Epub 2020 Nov 17. 10.1101/gr.261503.120 PubMed 33203764
Map uploaded by the depositor.
