Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CBSH3- shRNA2
(Plasmid #160210)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160210 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARHGEF9
  • Alt name
    Collybistin
  • gRNA/shRNA sequence
    TGACGTTGCTCTGGGTGAACCA
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Entrez Gene
    Arhgef9
  • Promoter mouse U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site Xba (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Targets collybistin MTL-CBSH3- mRNA (target is located in the protein coding region. Putative rat sequence based on human sequence - targets nucleotides 813-834 of human NM_001353924.2. Targets MTL collybistin isoforms without SH3 domain). There is also the mutated shRNA control for this isoform (Addgene #160211).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CBSH3- shRNA2 was a gift from Angel de Blas (Addgene plasmid # 160210 ; http://n2t.net/addgene:160210 ; RRID:Addgene_160210)