pRK5-α5last
(Plasmid
#160270)
-
PurposeExpresses a concatemeric construct of a α4:β2:α5 (2:2:1) nAChR
-
Depositing Lab
-
Depositing OrganizationInstitut Pasteur
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 160270-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 160270-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepKR5
- Backbone size w/o insert (bp) 4668
- Total vector size (bp) 12783
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameα5last concatemer
-
Alt nameα4-β2-α4-β2-α5 concatemer
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8115
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GCCTTTCTCTCCACAGGTGTCC
- 3′ sequencing primer GTGAAATTTGTGATGCTATTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 160270-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 160270-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-α5last was a gift from Pierre-Jean Corringer (Addgene plasmid # 160270 ; http://n2t.net/addgene:160270 ; RRID:Addgene_160270) -
For your References section:
Concatemers to re-investigate the role of alpha5 in alpha4beta2 nicotinic receptors. Prevost MS, Bouchenaki H, Barilone N, Gielen M, Corringer PJ. Cell Mol Life Sci. 2020 May 29. pii: 10.1007/s00018-020-03558-z. doi: 10.1007/s00018-020-03558-z. 10.1007/s00018-020-03558-z PubMed 32472188