Skip to main content

pEGB2_alpha2 P35S:CUP2:GAL4AD:T35S (GB1039)
(Plasmid #160607)

  • Purpose
    TU for the constitutive expression of the transcriptional activator protein CUP2 in C-terminal fusion with GAL4 activation domain (GAL4AD). Binds to specific DNA operator in the presence of copper ions and promotes transcription.
  • Depositing Lab
  • Depositing Organization
    Agencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
    Located in Spain
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160607 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDGB3_alpha2
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CUP2Gal4AD
  • Species
    Synthetic
  • Insert Size (bp)
    2191
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter P35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmBI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGB2_alpha2 P35S:CUP2:GAL4AD:T35S (GB1039) was a gift from Diego Orzaez (Addgene plasmid # 160607 ; http://n2t.net/addgene:160607 ; RRID:Addgene_160607)