Skip to main content

pLV_ADRB2-mTurquoise2-iLID
(Plasmid #161002)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161002 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti 2nd gen
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 11730
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ADRB2-mTurquoise2-iLID
  • Species
    Synthetic
  • Insert Size (bp)
    2490
  • Promoter EF1a
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggagtacgtcgtctttaggt
  • 3′ sequencing primer cgtcttttggcaatgtgagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The iLID sequence was originally cloned by Dr. Brian Kuhlman's lab (Addgene plasmid #60411)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_ADRB2-mTurquoise2-iLID was a gift from Sean R Collins (Addgene plasmid # 161002 ; http://n2t.net/addgene:161002 ; RRID:Addgene_161002)
  • For your References section:

    Optimized iLID Membrane Anchors for Local Optogenetic Protein Recruitment. Natwick DE, Collins SR. ACS Synth Biol. 2021 May 21;10(5):1009-1023. doi: 10.1021/acssynbio.0c00511. Epub 2021 Apr 12. 10.1021/acssynbio.0c00511 PubMed 33843200