pJT040 lenti MCS pEF mIFP WPRE
(Plasmid #161929)

• Purpose: Lentiviral expression of mIFP with multiple cloning site upstream the pEF promoter
• Depositing Labs: Michael Bassik, Lacra Bintu
• Publication: Tycko et al Cell. 2020 Dec 9. pii: S0092-8674(20)31541-5. doi: 10.1016/j.cell.2020.11.024.

Backbone

• Vector backbone: pMCB320
• Backbone size w/o insert (bp): 8907
• Total vector size (bp): 8047
• Modifications to backbone: Replace mCherry Puro with mIFP. Replace U6 sgRNA with MCS.
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mIFP
• Promoter: pEF

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggatcttggttcattctcaagcctc

Resource Information

• Supplemental Documents:
  • pMCB822 pjt040-lenti-mcs-pef-mifp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Lentiviral vector for expression of mIFP. Has a multiple cloning site upstream of the pEF-mIFP cassette.

Cloned with reagents shared by and in collaboration with Michael Bassik.