-
PurposeLentiviral backbone for GoldenGate cloning effectors as a fusion with rTetR(SE-G72P)-3XFLAG
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJT050
- Backbone size w/o insert (bp) 8932
- Total vector size (bp) 9001
-
Modifications to backbonereplace rTetR with rTetR(SE-G72P)-3XFLAG
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerTetR(SE-G72P)
- Promoter pEF
-
Tag
/ Fusion Protein
- 3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatcttggttcattctcaagcctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone plasmid for cloning individual effectors or libraries of effector domains using GoldenGate cloning with BsmBI. rTetR(SE-G72P) is an engineered variant with reduced leakiness (Roney et al., 2016 PMC4914848).
Cloned with reagents shared by and in collaboration with Michael Bassik.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJT126 lenti pEF-rTetR(SE-G72P)-3XFLAG-LibCloneSite-T2A-mCherry-BSD-WPRE was a gift from Michael Bassik & Lacra Bintu (Addgene plasmid # 161926 ; http://n2t.net/addgene:161926 ; RRID:Addgene_161926) -
For your References section:
High-Throughput Discovery and Characterization of Human Transcriptional Effectors. Tycko J, DelRosso N, Hess GT, Aradhana, Banerjee A, Mukund A, Van MV, Ego BK, Yao D, Spees K, Suzuki P, Marinov GK, Kundaje A, Bassik MC, Bintu L. Cell. 2020 Dec 9. pii: S0092-8674(20)31541-5. doi: 10.1016/j.cell.2020.11.024. 10.1016/j.cell.2020.11.024 PubMed 33326746