pCCM’ CbbQ-
(Plasmid #162711)

• Purpose: Second CCM operon with inactive CbbQ (K46A, E107Q) rubisco activase
• Depositing Lab: David Savage
• Publication: Flamholz et al Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882.

Backbone

• Vector backbone: pFA31 (derived from pZA31 expressing under PLtet0-1 and constitutive tetR)
• Backbone size w/o insert (bp): 2980
• Total vector size (bp): 14585
• Modifications to backbone: The p15A origin was replaced with high-copy colE1 origin.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Second CCM operon cloned from H. neapolitanus
• Species: Halothiobacillus neapolitanus
• Insert Size (bp): 11605
• Mutation: Inactivation of CbbQ subunit of CbbOQ rubisco activase (CbbQ K46A, E107Q)
• Promoter: PLtet0-1 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggaacctcttacgtgccgatc
• 3′ sequencing primer: GCGTTCACCGACAAACAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Inactivation of CbbQ subunit of CbbOQ rubisco activase in pCCM'