SL2-sgTelo-MTSa/BFP/pdCas9-C1
(Plasmid
#162760)
-
PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeres
-
Depositing Lab
-
Depositing OrganizationPeking University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 162760-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 162760-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 and sgRNA(SL2-sgTelo-MTSa)
-
gRNA/shRNA sequenceGTTAGGGTTAGGGTTAGGGTTAGTTTGAGAGCTATGCTGGAAACAGCATAGCAAGT TCAAATAAGGCTAGTCCGTTATCAACTTGGCCCCGGAGCAGAACGACAGGAGTTG TGTTTGTGGACGAAGAGCCTGCAGTCTGCTCCGGGGCCAGTGGCACCGAGTCGG TGCTTTTTTT
-
SpeciesH. sapiens (human)
-
MutationdCas9(nuclease deactivated Cas9)
- Promoter U6/CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer LKO 1-5
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 162760-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 162760-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SL2-sgTelo-MTSa/BFP/pdCas9-C1 was a gift from Antony K Chen (Addgene plasmid # 162760 ; http://n2t.net/addgene:162760 ; RRID:Addgene_162760) -
For your References section:
A CRISPR/molecular beacon hybrid system for live-cell genomic imaging. Wu X, Mao S, Yang Y, Rushdi MN, Krueger CJ, Chen AK. Nucleic Acids Res. 2018 Jul 27;46(13):e80. doi: 10.1093/nar/gky304. 10.1093/nar/gky304 PubMed 29718399
