Skip to main content

SL2-sgSat-MTSb/BFP/pdCas9-C1
(Plasmid #162761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162761 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 162761-D50 50 μg of DNA in Tris buffer $495
DNA 162761-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9 and sgRNA(SL2-sgSat-MTSb)
  • gRNA/shRNA sequence
    GAATCTGCAAGTGGATATTGTTTGAGAGCTATGCTGGAAACAGCATAGCAAGTTCA AATAAGGCTAGTCCGTTATCAACTTGGCCCCGGAGCAGAAGACGTCACGACATCA CTTACGCTGAGTAGCTGCAGTCTGCTCCGGGGCCAGTGGCACCGAGTCGGTGCTT TTTTT
  • Species
    H. sapiens (human)
  • Mutation
    dCas9(nuclease deactivated Cas9)
  • Promoter U6/CMV

Cloning Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SL2-sgSat-MTSb/BFP/pdCas9-C1 was a gift from Antony K Chen (Addgene plasmid # 162761 ; http://n2t.net/addgene:162761 ; RRID:Addgene_162761)
  • For your References section:

    A CRISPR/molecular beacon hybrid system for live-cell genomic imaging. Wu X, Mao S, Yang Y, Rushdi MN, Krueger CJ, Chen AK. Nucleic Acids Res. 2018 Jul 27;46(13):e80. doi: 10.1093/nar/gky304. 10.1093/nar/gky304 PubMed 29718399