Skip to main content
Addgene
Open Menu

pcDNA-Fah_W
(Plasmid #163087)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163087 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 163087-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 163087-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5506
  • Total vector size (bp) 6764
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fah_W
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1258
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc-His (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-Fah_W was a gift from Joseph Takahashi (Addgene plasmid # 163087 ; http://n2t.net/addgene:163087 ; RRID:Addgene_163087)

  • For your References section:

    Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. Yang S, Siepka SM, Cox KH, Kumar V, de Groot M, Chelliah Y, Chen J, Tu B, Takahashi JS. Proc Natl Acad Sci U S A. 2019 Oct 29;116(44):22229-22236. doi: 10.1073/pnas.1904485116. Epub 2019 Oct 14. 10.1073/pnas.1904485116 PubMed 31611405
Related items:
Commonly requested with: