Skip to main content

PX459v2-ILK-gRNA 1-exon 1
(Plasmid #163320)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163320 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 163320-D50 50 μg of DNA in Tris buffer $495
DNA 163320-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 9200
  • Modifications to backbone
    Used BbsI sites to insert 21bp gRNA
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ILK gRNA 1_Exon1
  • Alt name
    guide RNA targeting Integrin-Linked Kinase
  • gRNA/shRNA sequence
    G*CGGAGAACGACCTCAACCAG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AddGene, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459v2-ILK-gRNA 1-exon 1 was a gift from Val Brunton (Addgene plasmid # 163320 ; http://n2t.net/addgene:163320 ; RRID:Addgene_163320)
  • For your References section:

    Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors. Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG. Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373. 10.1158/0008-5472.CAN-21-0373 PubMed 34921014