Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PX459v2-ILK-gRNA 2-exon 8
(Plasmid #163321)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163321 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 9200
  • Modifications to backbone
    Used BbsI sites to insert 21bp gRNA
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ILK gRNA 2_Exon8
  • Alt name
    guide RNA targeting Integrin-Linked Kinase, exon 8
  • gRNA/shRNA sequence
    G*ACATTGTAGAGGGATCCATA
  • Species
    H. sapiens (human)
  • Promoter U6F

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AddGene, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459v2-ILK-gRNA 2-exon 8 was a gift from Val Brunton (Addgene plasmid # 163321 ; http://n2t.net/addgene:163321 ; RRID:Addgene_163321)
  • For your References section:

    Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors. Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG. Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373. 10.1158/0008-5472.CAN-21-0373 PubMed 34921014