Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors.
Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG
Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373.
PubMed Article

Plasmids from Article

ID Plasmid Purpose
163320PX459v2-ILK-gRNA 1-exon 1SpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.
163321PX459v2-ILK-gRNA 2-exon 8SpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.
163322eSpCas9(1.1)-ABL1-gRNA1-exon4eCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.
163323eSpCas9(1.1)-ABL1-gRNA2-exon4eCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.

Antibodies from Article