-
PurposeExpresses both eGFP and firefly luciferase in mammalian cells
-
Depositing Lab
-
Depositing OrganizationIcahn School of Medicine at Mount Sinai
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneeGFP-C1
-
Backbone manufacturerConetech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6366
-
Vector typeMammalian Expression, Bacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
SpeciesFire Fly
-
Insert Size (bp)1688
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Ananda Mookerjee and Thomas Weber
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP-luciferase-C1 was a gift from Thomas Weber (Addgene plasmid # 163523 ; http://n2t.net/addgene:163523 ; RRID:Addgene_163523)