per2:iCBG (single color)
(Plasmid #163842)

• Purpose: This construct is a recombinant DNA sequence that target to mouse Per2 gene. And through homologous recombination, Per2 gene will be targeted with an inducible bioluminescence reporter cassette.
• Depositing Lab: Joseph Takahashi
• Depositing Organization: University of Texas Southwestern Medical Center
  Located in the United States of America
• Publication: Magana et al Proc Natl Acad Sci U S A. 2026 Jun 2;123(22):e2601012123. doi: 10.1073/pnas.2601012123. Epub 2026 May 26.

Backbone

• Vector backbone: homemade
• Backbone manufacturer: Yoo, S. H., et al. (2004). "PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillati
• Backbone size w/o insert (bp): 16257
• Total vector size (bp): 19791
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: per2:iCBR
• Species: M. musculus (mouse)
• Promoter: endogenous expression driven by targeted gene
• Tag / Fusion Protein:
  • inducible bioluminescence cassette (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: 5’ TAACCGCGGCAGCTTCTGATG 3’
• 3′ sequencing primer: 5’ ATCCTAACCGCCGGCCTTCAC 3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry