pJJF143_SECGFP_sg1
(Plasmid
#163864)
-
PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJJR50 (Waaijers et al. 2016)
-
Backbone manufacturerAddgene Plasmid #75026
- Backbone size w/o insert (bp) 3425
- Total vector size (bp) 3422
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting GFP
-
gRNA/shRNA sequenceGAGGGTGAGCTTTCCGTAGG(NGG)
-
SpeciesSynthetic
- Promoter R07E5.16 (U6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (aka BpiI) (destroyed during cloning)
- 3′ cloning site BbsI (aka BpiI) (destroyed during cloning)
- 5′ sequencing primer M13-24F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJJF143_SECGFP_sg1 was a gift from Nikolaus Rajewsky (Addgene plasmid # 163864 ; http://n2t.net/addgene:163864 ; RRID:Addgene_163864) -
For your References section:
Parallel genetics of regulatory sequences using scalable genome editing in vivo. Froehlich JJ, Uyar B, Herzog M, Theil K, Glazar P, Akalin A, Rajewsky N. Cell Rep. 2021 Apr 13;35(2):108988. doi: 10.1016/j.celrep.2021.108988. 10.1016/j.celrep.2021.108988 PubMed 33852857
