Skip to main content

pcDNA™5/FRT/CMV_promoter-Cas9-E2A-mRFP
(Plasmid #164131)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164131 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 164131-D50 50 μg of DNA in Tris buffer $495
DNA 164131-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA5-FRT
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9955
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4104
  • Entrez Gene
    cas9 (a.k.a. B6D67_RS04280, ERS445054_00848)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA™5/FRT/CMV_promoter-Cas9-E2A-mRFP was a gift from Hyongbum Kim (Addgene plasmid # 164131 ; http://n2t.net/addgene:164131 ; RRID:Addgene_164131)
  • For your References section:

    Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780