AAV-hRedOpsin-TGFB3
(Plasmid #164429)

• Purpose: AAV plasmid expressing TGFB3 in photoreceptors
• Depositing Lab: Connie Cepko
• Publication: Wang et al J Clin Invest. 2020 Aug 3;130(8):4360-4369. doi: 10.1172/JCI136160.

Backbone

• Vector backbone: AAV-MCS8
• Backbone manufacturer: Jeng-Shin Lee, Harvard University
• Backbone size w/o insert (bp): 6062
• Total vector size (bp): 7310
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tgfb3
• Alt name: transforming growth factor beta 3
• Species: M. musculus (mouse)
• Insert Size (bp): 1248
• Entrez Gene: Tgfb3 (a.k.a. TGF-beta-3, Tgfb-3)
• Promoter: human red opsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: gagcacaatgaactggccgt
• 3′ sequencing primer: tccgctggattgagggccgaa

Resource Information

• Supplemental Documents:
  • AAV-hRO-TGFB3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry