pAAV-EF1a-DIO-mGreenLantern
(Plasmid #164468)

• Purpose: Cre-dependent EF1a-driven expression of mGreenLantern in animals using AAV
• Depositing Lab: Gregory Petsko
• Publication: Campbell et al Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mGreenLantern
• Species: H. sapiens (human)
• Insert Size (bp): 720
• Mutation: Clover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L221K/F223R/G232D
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bsp1407I (not destroyed)
• 3′ cloning site: NcoI (not destroyed)
• 5′ sequencing primer: TTATGCAGAATGGTAGCTGGATTG
• 3′ sequencing primer: WPRE-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cre-inducible expression (double floxed inverted ORF)