-
PurposeLentiviral vector for constitutive expression of HER2+TM(23-675)-BFP
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR'SIN
- Backbone size w/o insert (bp) 9033
- Total vector size (bp) 11791
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExtracellular and transmembrane region of ERBB2
-
Alt nameHER2_ECD+TM(23-675)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1959
-
Entrez GeneERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
- Promoter SFFV
-
Tag
/ Fusion Protein
- tagBFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTCTGCTTCCCGAGCTCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_SFFv_Her2-BFP_RHL027 was a gift from Wendell Lim (Addgene plasmid # 164823 ; http://n2t.net/addgene:164823 ; RRID:Addgene_164823) -
For your References section:
T cell circuits that sense antigen density with an ultrasensitive threshold. Hernandez-Lopez RA, Yu W, Cabral KA, Creasey OA, Lopez Pazmino MDP, Tonai Y, De Guzman A, Makela A, Saksela K, Gartner ZJ, Lim WA. Science. 2021 Mar 12;371(6534):1166-1171. doi: 10.1126/science.abc1855. Epub 2021 Feb 25. 10.1126/science.abc1855 PubMed 33632893