Skip to main content
Addgene
Open Menu

RfxCas13d-backbone
(Plasmid #165078)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165078 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 165078-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 165078-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scaffold gRNA
  • gRNA/shRNA sequence
    aacccctaccaactggtcggggtttgaaac
  • Species
    Other

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that viral vectors are prone to recombination. Addgene recommends testing 2-4 individual colonies to ensure the full plasmid is intact.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RfxCas13d-backbone was a gift from Ling-Ling Chen (Addgene plasmid # 165078 ; http://n2t.net/addgene:165078 ; RRID:Addgene_165078)

  • For your References section:

    Screening for functional circular RNAs using the CRISPR-Cas13 system. Li S, Li X, Xue W, Zhang L, Yang LZ, Cao SM, Lei YN, Liu CX, Guo SK, Shan L, Wu M, Tao X, Zhang JL, Gao X, Zhang J, Wei J, Li J, Yang L, Chen LL. Nat Methods. 2021 Jan;18(1):51-59. doi: 10.1038/s41592-020-01011-4. Epub 2020 Dec 7. 10.1038/s41592-020-01011-4 PubMed 33288960
Related items:
Commonly requested with: