ORF3a-EGFP
(Plasmid #165121)

• Purpose: mammalian expression and localization
• Depositing Lab: Bruno Antonny
• Depositing Organization: CNRS UMR 7275, Institut de Pharmacologie Moleculaire et Cellulaire (IPMC)
  Located in France
• Publication: Miserey-Lenkei et al Biol Cell. 2021 Jul;113(7):311-328. doi: 10.1111/boc.202000158. Epub 2021 May 10.
• Citations: 1 Article

Backbone

• Vector backbone: pEGFPN1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORF3a
• Species: codon optimized SARS-COV-2
• Insert Size (bp): 800
• Entrez Gene: ORF3a (a.k.a. GU280_gp03)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GTCGTAACAACTCCGCCC
• 3′ sequencing primer: CGTCCAGCTCGACCAGGATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Inserts were prepared by PCR with templates that have been published elsewhere: Gordon et al., 2020a.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.12.19.423586v1 for BioRxiv preprint. bioRxiv 2020.12.19.423586v1

DNA (Catalog # 165121-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 165121-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.