Skip to main content

MSCV-Tox2-IRES-eGFP
(Plasmid #165428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165428 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 165428-D50 50 μg of DNA in Tris buffer $495
DNA 165428-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    MSCV-IRES-eGFP
  • Backbone manufacturer
    Tannishtha Reya Lab
  • Backbone size w/o insert (bp) 6400
  • Total vector size (bp) 8088
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TOX2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1644
  • GenBank ID
    NP_001092269
  • Entrez Gene
    Tox2 (a.k.a. AI851523, AV026525, BI987407, Gcx1, RxHMG, RxHMG1)
  • Promoter 5' LTR
  • Tag / Fusion Protein
    • 3xflag 5' of Tox2 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCCGTCTCTCCCCCTTGAAC
  • 3′ sequencing primer GCCAAAAGACGGCAATATGGTGGAAAATAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Tox2-IRES-eGFP was a gift from Patrick Hogan & Anjana Rao (Addgene plasmid # 165428 ; http://n2t.net/addgene:165428 ; RRID:Addgene_165428)
  • For your References section:

    TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, Wu CJ, Lu LF, Hogan PG, Bhandoola A, Rao A. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12410-12415. doi: 10.1073/pnas.1905675116. Epub 2019 May 31. 10.1073/pnas.1905675116 PubMed 31152140