MSCV-Tox2-IRES-eGFP
(Plasmid
#165428)
-
PurposeExpresses TOX2 in mammalian cells
-
Depositing Labs
-
Depositing OrganizationLa Jolla Institute for Immunology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 165428-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 165428-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMSCV-IRES-eGFP
-
Backbone manufacturerTannishtha Reya Lab
- Backbone size w/o insert (bp) 6400
- Total vector size (bp) 8088
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOX2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1644
-
GenBank IDNP_001092269
-
Entrez GeneTox2 (a.k.a. AI851523, AV026525, BI987407, Gcx1, RxHMG, RxHMG1)
- Promoter 5' LTR
-
Tag
/ Fusion Protein
- 3xflag 5' of Tox2 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCCGTCTCTCCCCCTTGAAC
- 3′ sequencing primer GCCAAAAGACGGCAATATGGTGGAAAATAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 165428-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 165428-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Tox2-IRES-eGFP was a gift from Patrick Hogan & Anjana Rao (Addgene plasmid # 165428 ; http://n2t.net/addgene:165428 ; RRID:Addgene_165428) -
For your References section:
TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, Wu CJ, Lu LF, Hogan PG, Bhandoola A, Rao A. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12410-12415. doi: 10.1073/pnas.1905675116. Epub 2019 May 31. 10.1073/pnas.1905675116 PubMed 31152140